Chrysanthenum transcriptome database

Information for unigene UN97544

FASTA Sequence
Unigene ID: UN97544Length: 283 SSR
TCATAGAAATATATGATTCATACCTTTTATTTATATCATTTGTTCTTTCATCACATTTTGCAACTAGTAAGTGGCATACATGATTC
ACAAGCTCTTGTTTGATGTTCCTATTCTTATGAAGTACATGGACTAGTTTCCATGATAATTATACACCTTATTTTGAACCACAACC
ACCACCTCCACGACAACCACCACTACAACTGGCACGACATCCTGAACAACTCGCACGACATCCACCACCACCACCACCACCACAAC
CTATATATACACAAAACTATATGTG

Annotation (GO annotation)
GenBank top hits (Blast detail)Scoree value
CAK37982 hypothetical protein An02g14960 [Aspergillus niger]1394e-007
EJK58261 hypothetical protein THAOC_21634, partial [Thalassiosira oceanica]1386e-007
CAK40453 hypothetical protein An09g06600 [Aspergillus niger]1377e-007
EGD79530 hypothetical protein PTSG_12992 [Salpingoeca sp. ATCC 50818]1377e-007
XP_627858 protein with signal peptide plus thr stretch, cys rich, possible mucin [Cryptosporidium parvum Iowa II]1369e-007

Swiss-Prot top hits (Blast detail)Scoree value
Q86IE6 Putative uncharacterized protein DDB_G02756291246e-007
P04929 Histidine-rich glycoprotein1192e-006
Q8MP30 Uncharacterized histidine-rich protein DDB_G02745571157e-006

TrEMBL top hits (Blast detail)Scoree value
A2QFL4 Putative uncharacterized protein1395e-007
A2QUS3 Putative uncharacterized protein1378e-007
F2UPH5 Putative uncharacterized protein1378e-007
E1GG97 CAMK/DAPK/DAPK protein kinase1361e-006
Q5CWE6 Protein with signal peptide plus thr stretch, cys rich, possible mucin1361e-006

Arabidopsis top hits (Blast detail)Scoree value
AT3G10810.1 zinc finger (C3HC4-type RING finger) family protein1093e-006