Chrysanthenum transcriptome database

Information for unigene UN85978

FASTA Sequence
Unigene ID: UN85978Length: 246 SSR
TGGTTGTGCAGGTTGTTGGGCTTGCTGCTGCTGCTGTTGTTGTTCCTCAGGTTGACTATTAACTTGCTGTGGTATTTGGGTTTGAC
CATGCATAAACTGTTGAGGAATGAGCTGTTGAATTTGCTGCTGTGACTGCTGAAAAAGCGGGTTAGAAGTGCCTGAAACTGAATGC
TGAGGGTATTGCATTGGCGGCTGTTGCTGCTGCTGCTGCTGCTGCTGCATCTGTACACCGGTATCATGCCCAAC

Annotation (GO annotation)
GenBank top hits (Blast detail)Scoree value
EGD74846 hypothetical protein PTSG_07076 [Salpingoeca sp. ATCC 50818]1654e-010
EFN89429 Calmodulin-binding transcription activator 1 [Harpegnathos saltator]1637e-010
EGD79459 hypothetical protein PTSG_10025 [Salpingoeca sp. ATCC 50818]1637e-010
EGD75604 hypothetical protein PTSG_06671 [Salpingoeca sp. ATCC 50818]1602e-009
EGS22134 hypothetical protein CTHT_0016500 [Chaetomium thermophilum var. thermophilum DSM 1495]1602e-009

Swiss-Prot top hits (Blast detail)Scoree value
O77033 General transcriptional corepressor trfA1571e-010
Q54NF3 Uncharacterized protein DDB_G02852911542e-010
Q86AF2 Putative uncharacterized protein DDB_G02716061524e-010
Q54DK4 Alpha-protein kinase 11506e-010
Q55F68 Adenylate cyclase, terminal-differentiation specific1506e-010

TrEMBL top hits (Blast detail)Scoree value
F2UDZ6 Putative uncharacterized protein1655e-010
E2B4D5 Calmodulin-binding transcription activator 1 (Fragment)1638e-010
F2UPA4 Putative uncharacterized protein1638e-010
G0S2A1 Putative uncharacterized protein1602e-009
F2UFN6 Putative uncharacterized protein1602e-009

Arabidopsis top hits (Blast detail)Scoree value
AT4G32551.1 LUG (LEUNIG); protein binding / protein heterodimerization/ transcription repressor1326e-009
AT1G25540.1 PFT1 (PHYTOCHROME AND FLOWERING TIME 1); transcription coactivator1236e-008
AT1G25540.2 PFT1 (PHYTOCHROME AND FLOWERING TIME 1); transcription coactivator1236e-008
AT5G20730.1 NPH4 (NON-PHOTOTROPHIC HYPOCOTYL); DNA binding / transcription activator/ transcription factor/ transcription regulator1192e-007
AT5G20730.2 NPH4 (NON-PHOTOTROPHIC HYPOCOTYL); DNA binding / transcription activator/ transcription factor/ transcription regulator1192e-007