Chrysanthenum transcriptome database

Information for unigene UN47666

FASTA Sequence
Unigene ID: UN47666Length: 349 SSR
TTAATATTGGAATTTAAAGCTAAAGCTCTTTGTCTCAAAGAAGCTTCTTCTTGGGAGTTTCTTGAAATCAAAGTAGCTGCTGATTC
TTGCAGCTCTTTACTTTGTTCCAAGATTCTTGATACTTCTTCTGCAGTGTTTCTTTCTGATGAGTTACTGTTGTCACCCATTTGAA
AGAAATGGGTCGATCTAGTGGTGGCTTTTGGGTGATGAATGTGGAGGCAATGATGGGTTTTGCGGTGAGTGAACGGTGGTTTATGG
TGGTGAATCTAGAGCACACAAAGTGGTGATGATGATGATGATGAGTGGAAGTGGCTTTTTTTTAGACTTTAGCACTGTGTTCTTAA
GTTTT

Annotation (GO annotation)
GenBank top hits (Blast detail)Scoree value
XP_002317646 predicted protein [Populus trichocarpa]1377e-007
XP_002518967 conserved hypothetical protein [Ricinus communis]1341e-006

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
B9I0N0 Predicted protein1377e-007
B9RYZ8 Putative uncharacterized protein1342e-006

Arabidopsis top hits (Blast detail)Scoree value
AT4G10430.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: TMPIT-like (InterPro:IPR012926); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G33230.1); Has 196 Blast hits to 196 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 146; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).1121e-006
AT4G10430.3 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: TMPIT-like (InterPro:IPR012926); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G33230.1); Has 196 Blast hits to 196 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 146; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).1121e-006
AT1G33230.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TMPIT-like (InterPro:IPR012926); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G10430.3); Has 198 Blast hits to 198 proteins in 60 species: Archae - 0; Bacteria - 0; Metazoa - 148; Fungi - 0; Plants - 40; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).1092e-006