Chrysanthenum transcriptome database

Information for unigene UN38628

FASTA Sequence
Unigene ID: UN38628Length: 308 SSR
GTGGTGGTGGTGGTGGTGGTGGTCGTGGTGTTGGTGGTGGTGGTGAAAGATGTCGCAATGGTGGTGGGGGAGGGCTATGTGGTGGA
TGAACAGGCGGAGAAACAGGAGGAAACACTGGAGGATGCTTATGTGCATTTTTTTTCTTGTGAGAATCTGGCGGCTTTGCGTTGTG
ACTCTTCTGAGGTGCAGGGGTAGGGACGGGAGGGGGTGCAGGAGAGTGTTTTGATCGACCTTTTTCATTAGGTGAAGGTGGTTTTG
CAGGCGGCAGTTGTTTGTCATGGTGGTGGTGGTGATGATGATGATGATGA

Annotation (GO annotation)
GenBank top hits (Blast detail)Scoree value
XP_002954263 extracellular matrix glycoprotein pherophorin-V40 [Volvox carteri f. nagariensis]2174e-016
XP_002945770 pathogenesis-related protein 1-like protein [Volvox carteri f. nagariensis]2102e-015
XP_002945771 pathogenesis-related protein 1-like protein [Volvox carteri f. nagariensis]2093e-015
ABA41399 pherophorin-C1 protein precursor [Chlamydomonas reinhardtii]2075e-015
XP_002951232 hypothetical protein VOLCADRAFT_61191 [Volvox carteri f. nagariensis]2059e-015

Swiss-Prot top hits (Blast detail)Scoree value
P48038 Acrosin1802e-013
P21997 Sulfated surface glycoprotein 1851783e-013
Q9FPQ6 Vegetative cell wall protein gp11766e-013
A3AB67 Formin-like protein 161622e-011
Q64467 Glyceraldehyde-3-phosphate dehydrogenase, testis-specific1613e-011

TrEMBL top hits (Blast detail)Scoree value
D8U6B9 Extracellular matrix glycoprotein pherophorin-V402174e-016
D8THS2 Pathogenesis-related protein 1-like protein2103e-015
D8THS6 Pathogenesis-related protein 1-like protein2093e-015
Q3HTK6 Pherophorin-C1 protein (Precursor)2076e-015
F6HJS7 Putative uncharacterized protein2068e-015

Arabidopsis top hits (Blast detail)Scoree value
AT4G13340.1 leucine-rich repeat family protein / extensin family protein1863e-015
AT4G15160.1 lipid binding / structural constituent of cell wall1801e-014
AT4G15160.2 lipid binding / structural constituent of cell wall1801e-014
AT2G15880.1 leucine-rich repeat family protein / extensin family protein1792e-014
AT4G22505.1 INVOLVED IN: lipid transport; CONTAINS InterPro DOMAIN/s: Bifunctional inhibitor/plant lipid transfer protein/seed storage (InterPro:IPR016140), Plant lipid transfer protein/seed storage/trypsin-alpha amylase inhibitor (InterPro:IPR003612), Plant lipid transfer protein and hydrophobic protein, helical (InterPro:IPR013770); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22485.1).1693e-013