Chrysanthenum transcriptome database

Information for unigene UN30179

FASTA Sequence
Unigene ID: UN30179Length: 240 SSR
AACACCTCAAAGCAACATCCATTCTAAAACTACATAACCAACCACAACAGTCCAAGCATCAACACCGGTGTATTGGCGACCACCAC
CAGAGTAAATTTGCAAGGTGAAAGGATGATAAACATTAGTAGGTGGATTTGTTACGTAAATGAACCGCGGTGGAGGAGGTGGTTTT
ACTGCAACAATAGGAGGACATAAGACTAATGGTGGTGGTGGTGGAGGTGGTAGTGGAGGTGGAGGTGG

Annotation (GO annotation)
GenBank top hits (Blast detail)Scoree value
XP_003631207 PREDICTED: uncharacterized protein LOC100255988 [Vitis vinifera]1441e-007
XP_001379720 PREDICTED: transcription factor SOX-30-like [Monodelphis domestica]1422e-007
XP_001896034 hypothetical protein [Brugia malayi]1403e-007
XP_002888811 hypothetical protein ARALYDRAFT_476229 [Arabidopsis lyrata subsp. lyrata]1342e-006
NP_188919 leucine-rich repeat extensin-like protein 6 [Arabidopsis thaliana]1323e-006

Swiss-Prot top hits (Blast detail)Scoree value
Q9LUI1 Leucine-rich repeat extensin-like protein 61363e-008
Q9T0K5 Leucine-rich repeat extensin-like protein 31247e-007
Q91Z58 Uncharacterized protein C6orf132 homolog1239e-007
Q9XIL9 Pollen-specific leucine-rich repeat extensin-like protein 31202e-006
Q8C4A5 Putative Polycomb group protein ASXL31193e-006

TrEMBL top hits (Blast detail)Scoree value
A5B8N9 Putative uncharacterized protein1441e-007
A8PDS9 Putative uncharacterized protein1404e-007
D7KYH4 Putative uncharacterized protein (Fragment)1342e-006
B7QDE3 Putative uncharacterized protein (Fragment)1297e-006
B7PC66 Putative uncharacterized protein (Fragment)1289e-006

Arabidopsis top hits (Blast detail)Scoree value
AT3G22800.1 leucine-rich repeat family protein / extensin family protein1362e-009
AT4G15160.1 lipid binding / structural constituent of cell wall1254e-008
AT4G15160.2 lipid binding / structural constituent of cell wall1254e-008
AT4G13340.1 leucine-rich repeat family protein / extensin family protein1245e-008
AT1G70990.1 proline-rich family protein1211e-007