Chrysanthenum transcriptome database

Information for unigene UN03586

FASTA Sequence
Unigene ID: UN03586Length: 898 SSR
CCATCATCCGTCAACAATCCTACACAACGTCTAACTAATTGCTTAAAATTCCAACACGATATAGTTTTACTACATCATATACTATC
AACCAACAAATTCAATGGCGATACAGAACAGATCTACAGATAAAAGAATGACATTACATATAACTAGTAATATGGTACCTCAAATT
CAAACACTGCCACCAGCCCACCACCATCATCGTCGTCATATTCGGATTTGAATTTTGATTTTAAAATTTCGACGCATATAGTAACA
TCAAGCGGTACTACTAGGTATTGATAGTAAGTAAATGAATATTGCTGTCATCGTTCCCAGTAGCATACCCATGATAACCTGAGGAG
GGGTGTGGCCAAGAAGTTCACGTAACGGCCTGCTCTCAGCCAAGGGATGTTCAGCAGGAAGCTCAAATACAATTTGGTTCAAAACC
TCTGCTTGGCGCCCAGCATGTAATCTTACTCCCGTCGCATCATACATCACGATGCAAGCCAAAATCAGTGCAGTTGCAAAAGTAGA
ACCGCCAAGGCCATCATGTAAACCAACAGCAACCGCAAGAGCAGTGACTGTTGCAGAATGTGATGAAGGCATGCCACCAGACCCAA
TAAGTTGCTTAAGATCCCAACGGTGTTCCTTATACCAGGTAGTAAAGACTTTAATGGATTGAGCTAGAGCAAAAGCAGCAAGTGCA
GAAATCAAAGCGTAGTTCATGTATAACGGAGGCCTTGATGGTGAAGATGATGACGTGGCGGTTGTTAAGTTTAACGGAGGTGATGA
TGACGTGTCCGTTTGTTGATGATTCATCACTATTTCACCTATTGATCTCATTTTTTTTATATATAGAAATGAATTTGTATCACTGT
GTGTGTGTGTTTTTAGTGCGTGTAAAATTGGGAATGAA

Annotation (GO annotation)
GenBank top hits (Blast detail)Scoree value
XP_002514991 conserved hypothetical protein [Ricinus communis]4725e-045
XP_002315626 predicted protein [Populus trichocarpa]4663e-044
NP_564215 Acid phosphatase/vanadium-dependent haloperoxidase-related protein [Arabidopsis thaliana]4653e-044
AAM63820 unknown [Arabidopsis thaliana]4653e-044
XP_003551646 PREDICTED: uncharacterized membrane protein yuiD-like [Glycine max]4653e-044

Swiss-Prot top hits (Blast detail)Scoree value
O32107 Uncharacterized membrane protein yuiD1442e-008

TrEMBL top hits (Blast detail)Scoree value
B9RMM2 Putative uncharacterized protein4725e-045
B9HTA9 Predicted protein4663e-044
I1KRZ5 Uncharacterized protein4663e-044
B9DG97 AT1G24350 protein4653e-044
I1MYI0 Uncharacterized protein4653e-044

Arabidopsis top hits (Blast detail)Scoree value
AT1G24350.1 INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67600.1); Has 626 Blast hits to 626 proteins in 204 species: Archae - 0; Bacteria - 365; Metazoa - 0; Fungi - 0; Plants - 103; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink).4651e-046
AT1G67600.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system; EXPRESSED IN: 9 plant structures; EXPRESSED DURING: 4 anthesis, C globular stage, petal differentiation and expansion stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G24350.1); Has 627 Blast hits to 627 proteins in 204 species: Archae - 0; Bacteria - 365; Metazoa - 0; Fungi - 0; Plants - 103; Viruses - 0; Other Eukaryotes - 159 (source: NCBI BLink).4542e-045
AT1G24350.2 INVOLVED IN: biological_process unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67600.1); Has 622 Blast hits to 622 proteins in 204 species: Archae - 0; Bacteria - 365; Metazoa - 0; Fungi - 0; Plants - 103; Viruses - 0; Other Eukaryotes - 154 (source: NCBI BLink).4282e-042
AT3G21610.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67600.1); Has 626 Blast hits to 626 proteins in 204 species: Archae - 0; Bacteria - 365; Metazoa - 0; Fungi - 0; Plants - 103; Viruses - 0; Other Eukaryotes - 158 (source: NCBI BLink).3744e-036
AT3G21610.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Acid phosphatase/vanadium-dependent haloperoxidase related (InterPro:IPR003832); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G67600.1); Has 610 Blast hits to 610 proteins in 200 species: Archae - 0; Bacteria - 358; Metazoa - 0; Fungi - 0; Plants - 102; Viruses - 0; Other Eukaryotes - 150 (source: NCBI BLink).3385e-032